View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15501_low_7 (Length: 291)
Name: NF15501_low_7
Description: NF15501
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15501_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 79 - 270
Target Start/End: Complemental strand, 43099869 - 43099677
Alignment:
| Q |
79 |
ctatactgctaccttatagtacgcatatcatcataaagtatagtatacannnnnnnnn-ggtcaagtaagtatagcatatatcgtgcatatgatgttata |
177 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43099869 |
ctatactactaccttatagtacgcatatcatcataaaatatagtatacatattttttttggtcaagtaagtatagcatatatcgtgcatacgatgttata |
43099770 |
T |
|
| Q |
178 |
gttttttgactttttattgcttggacaaacaatttcttaattacttaattgtagggtggatgatgcaattttattaatgcatatagtatttat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099769 |
gttttttgactttttattgcttggacaaacaatttcttaattacttaattgtagggtggatgatgcaattttattaatgcatatagtatttat |
43099677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University