View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15502_high_4 (Length: 245)
Name: NF15502_high_4
Description: NF15502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15502_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 440190 - 440124
Alignment:
| Q |
111 |
tcaggcggtggtggaagcggaggagattatggtggtggaagtggaggaggtagttctggcggcggaa |
177 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
440190 |
tcaggtggtggtggaagcggaggagattatggtggtggaagtggaggaggtagttctggcggcggaa |
440124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 149
Target Start/End: Complemental strand, 453065 - 453033
Alignment:
| Q |
117 |
ggtggtggaagcggaggagattatggtggtgga |
149 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
453065 |
ggtggtggcagcggaggagattatggtggtgga |
453033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University