View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15502_low_4 (Length: 387)
Name: NF15502_low_4
Description: NF15502
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15502_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 214 - 370
Target Start/End: Original strand, 46778462 - 46778618
Alignment:
| Q |
214 |
cacgatgtctcaactgtgtaaaatttcgatcccatatcctagttgagttattttagaggatgtggtctacttgcttgcttagctgtggttacaatttgat |
313 |
Q |
| |
|
||||| |||||||||| | ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46778462 |
cacgacgtctcaactgcgcaaaatttcgatcccatatcttagttgagttattttagaggatgtagtctacttgcttgcttagctgtggttacaatttgat |
46778561 |
T |
|
| Q |
314 |
gaagtataaagtaaagataaaatttagaagtcaacatattaagtataggtcgaagct |
370 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46778562 |
gaagtataaagtaaagataaaatttagaagtcaacatattaagtataggtcgaagct |
46778618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 46778251 - 46778383
Alignment:
| Q |
1 |
ataaactaaagtgtttgttttagttcataggcaccttttgaaagnnnnnnnnnatcaattgagatttctcacggcgcgaggatccaacatttacgtaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||| | | | ||||||||||||| ||||| |
|
|
| T |
46778251 |
ataaactaaagtgtttgttttagttcaaaggtaccttttgaaagttttttt--atcaattgagatttctcacggtgagggaatccaacatttacataatc |
46778348 |
T |
|
| Q |
101 |
gatatatctgtagtggttcggtcaagatcagacgg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
46778349 |
gatatatctgtagtggttcggtcaagatcagacgg |
46778383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University