View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15503_high_20 (Length: 224)
Name: NF15503_high_20
Description: NF15503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15503_high_20 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 8858788 - 8858565
Alignment:
| Q |
1 |
aaatcaccaagtgtagctttcgcaggtggagaagttacaatactgtgcctcttatcaaaatttaaatatttttattgaagcggataaacgataaaaattt |
100 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8858788 |
aaatcaccaaatgtagcttttgcaggtggagaagttacagtactgtgtcttttatcaaaatttaaatatttttattgaagcggataaacgataaaaattc |
8858689 |
T |
 |
| Q |
101 |
gactcatctatttcttcgtttcgaagggacctctaaggtgtggacaaatgtcttgagttgaaccggtgtcatttttattactcctaaagaattatttgtt |
200 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8858688 |
gactcctctatttcttcgtttctaagggacctctaaggtgtggacaaatgtcttgagttggaccggtgtcatttttattactcctcaagaattatttgtt |
8858589 |
T |
 |
| Q |
201 |
tagttaggaagttggtgtttggaa |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8858588 |
tagttaggaagttggtgtttggaa |
8858565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 97 - 224
Target Start/End: Complemental strand, 8853547 - 8853420
Alignment:
| Q |
97 |
atttgactcatctatttcttcgtttcgaagggacctctaaggtgtggacaaatgtcttgagttgaaccggtgtcatttttattactcctaaagaattatt |
196 |
Q |
| |
|
||||||||||||||||||||| || | |||||||||||||||||||| || |||||||||| | | ||||||||||||||||| || |||| ||||| |
|
|
| T |
8853547 |
atttgactcatctatttcttcattgccgagggacctctaaggtgtggatgaagatcttgagttggatcagtgtcatttttattacttctcaagatttatt |
8853448 |
T |
 |
| Q |
197 |
tgtttagttaggaagttggtgtttggaa |
224 |
Q |
| |
|
|||| |||||||||||||| |||||||| |
|
|
| T |
8853447 |
tgttcagttaggaagttggcgtttggaa |
8853420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University