View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15503_high_21 (Length: 214)
Name: NF15503_high_21
Description: NF15503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15503_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 52 - 201
Target Start/End: Original strand, 52780317 - 52780466
Alignment:
| Q |
52 |
tgatcgtcttcctgcgttgttaaggccagttttcttcttgttctttgcagcacctggtgtggctagtttggcttgggaatctattgttggagattttgat |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52780317 |
tgatcgtcttcctgcgttgttaaggccagttttcttcttgttctttgcagcacctggtgtggctagtttggcttgggaatctattgttggagattttgat |
52780416 |
T |
 |
| Q |
152 |
actctttccaagatgctattctttttgtccctattcctcttcatctcact |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52780417 |
actctttccaagatgctattctttttgtccctattcctcttcatgtcact |
52780466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 83 - 189
Target Start/End: Original strand, 17470861 - 17470967
Alignment:
| Q |
83 |
ttcttcttgttctttgcagcacctggtgtggctagtttggcttgggaatctattgttggagattttgatactctttccaagatgctattctttttgtccc |
182 |
Q |
| |
|
||||||||||||||||| || ||| || ||||||||||||||||| ||||| || ||| | ||||||||| ||| |||||||| |||||| | |||| |
|
|
| T |
17470861 |
ttcttcttgttctttgctgctcctagtatggctagtttggcttggcaatctgtttgtggttactttgatactgcttctaagatgctgttctttctctccc |
17470960 |
T |
 |
| Q |
183 |
tattcct |
189 |
Q |
| |
|
| ||||| |
|
|
| T |
17470961 |
tcttcct |
17470967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University