View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15503_low_10 (Length: 393)
Name: NF15503_low_10
Description: NF15503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15503_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 18 - 362
Target Start/End: Complemental strand, 5353094 - 5352750
Alignment:
| Q |
18 |
ttatgaaggtgttactttattagggtgccttgtgttggtcaaattagttgagtcagtaactgaaagacagtggtactttgaatcaaggagggcaggaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5353094 |
ttatgaaggtgttactttattagggtgccttgtgttggtcaaattagttgagtcagtaactgaaagacagtggtactttgaatcaaggagggcaggaatg |
5352995 |
T |
|
| Q |
118 |
agaatgagatcctctttgatggttgcagtgtatgaaaagctattgaacctttcgagttttggaaggaaaaggcactcaaatggtgaaatcgtgactttca |
217 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5352994 |
agaatgagatcctctttaatggttgcagtgtatgaaaagctattgaacctttcgagttttggaaggaaaaggcactcaaatggtgaaatcgtgaatttca |
5352895 |
T |
|
| Q |
218 |
tagctgttgatgcatacagaatgggagagtttttgtactggtttcattcaggatggagttttgtgttgcaacttttgttatctatttgtgtacttttttg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5352894 |
tagctgttgatgcatacagaatgggagagtttttgtactggtttcattcaggatggagttttgtgttgcaacttttgttatctatttgtgtacttttttg |
5352795 |
T |
|
| Q |
318 |
gattgctggtcttaatgcagttcctgtgttgattcttctggtcat |
362 |
Q |
| |
|
||||| |||||||| |||| |||||| ||||||||||| ||||| |
|
|
| T |
5352794 |
gattgttggtcttagtgcaattcctggattgattcttcttgtcat |
5352750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University