View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15503_low_17 (Length: 284)
Name: NF15503_low_17
Description: NF15503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15503_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 283
Target Start/End: Complemental strand, 39466941 - 39466659
Alignment:
| Q |
1 |
tactccttctctaaatccggcctacaatcaaccaccaccgatctcggcgacggaacagtaatgcattgttgggttcccaaaacagctcaaaaacacaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39466941 |
tactccttctctaaatccggcctaaaatcaaccaccaccgatctcggcgacggaacagtaatgcattgttgggttcccaaaacagctcaaaaacacaaac |
39466842 |
T |
 |
| Q |
101 |
cttctcttattctcatccatggaatcggagccaacgcaatgtggcaatggaactctttcattcctgagctcacacaccacttcaatgtttacgtaccaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39466841 |
cttctcttattctcatccatggaatcggagccaacgcaatgtggcaatggaactctttcattcctgagctcacacaccacttcaatgtttacgtaccaga |
39466742 |
T |
 |
| Q |
201 |
cttgcttttctttggagattcttacacgaacagacctgaatgatcggagcagtttcaagcaaagtgtgttatgcgtatgctgg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39466741 |
cttgcttttctttggagattcttacacgaccagacctgaaagatcggagcagtttcaagcaaagtgtgttatgcgtgtgctgg |
39466659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University