View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15503_low_22 (Length: 255)
Name: NF15503_low_22
Description: NF15503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15503_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 11 - 127
Target Start/End: Complemental strand, 20659015 - 20658899
Alignment:
| Q |
11 |
cagagacggacactaacaaatatagttacactcaatttcttctatttgtatataaaaaccaaaaataaaattcagagtctatccaagaacttgctatcga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20659015 |
cagacacggacactaacaaatatagttacactcaatttcttctatttgcatataaaaaccaaaaataaaattcagagtctatccaagaacttgctatcga |
20658916 |
T |
|
| Q |
111 |
gcaactcatgtagtaag |
127 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
20658915 |
gcaactcatgtagtaag |
20658899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 138 - 255
Target Start/End: Complemental strand, 20658785 - 20658668
Alignment:
| Q |
138 |
cactaatagagggacgaatgtaatttttatctacataacacaaacacatcagattgaatagtacctaatgttgaaaagtctcaatatcggacaccatagg |
237 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20658785 |
cactaatagagggatgaatgtaatttttatctacataacacaaacacatcagattgaatagtgtctaatgttgaaaagtctcaatatcggacaccatagg |
20658686 |
T |
|
| Q |
238 |
aacacatatagctatatt |
255 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
20658685 |
aacacatatagctatatt |
20658668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University