View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15503_low_23 (Length: 245)
Name: NF15503_low_23
Description: NF15503
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15503_low_23 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 12 - 245
Target Start/End: Original strand, 38629881 - 38630114
Alignment:
| Q |
12 |
atgagaacaagccatttatagttttctactatttcagatgctgacaatggttttaaattgctggcagcaacctcattataactgtttttcatgtctatca |
111 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38629881 |
atgagaacaagccatttatagttttttactatttcagatgctgacaatggttttaaattgctggcagcaacctcattataacagtttttcatgtctatca |
38629980 |
T |
|
| Q |
112 |
aaagacatcacaaccgcaattgcaaccacatgtaactgcaatatagaagttcgcagcttaacctcaattacagtttaatattatagcgataaccgaatta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38629981 |
aaagacatcacaaccgcaattgcaaccacatgtaactgcaatatagaagttcacagcttaacctcaattacagtttaatattatagcgataaccgaatta |
38630080 |
T |
|
| Q |
212 |
gtatgacctcacaaatgcacgagggaagaatctg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38630081 |
gtatgacctcacaaatgcacgagggaagaatctg |
38630114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 23 - 71
Target Start/End: Complemental strand, 38696089 - 38696041
Alignment:
| Q |
23 |
ccatttatagttttctactatttcagatgctgacaatggttttaaattg |
71 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
38696089 |
ccatttatagttttctactatttcacatgccgacaatagttttaaattg |
38696041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University