View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15504_high_10 (Length: 299)
Name: NF15504_high_10
Description: NF15504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15504_high_10 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 22 - 299
Target Start/End: Original strand, 6329486 - 6329763
Alignment:
| Q |
22 |
gggcttgtggatggaatatctcttgggaagttacaatcttatactcgtgatttcagtttattattctcttctacctcttcctcttttggcaagagatgcc |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6329486 |
gggcttgtggatggaatatctcttgggaagttacaatcttatactcgtgatttcagtttattattctcttctacctcttcctcttttggcaagagatgcc |
6329585 |
T |
|
| Q |
122 |
aattggttagtttatgattatgggttactactaagtttggcttttaatgaaagcattgtgatttttcttttactttggcaatttaatttggttcatggca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6329586 |
aattggttagtttatgattatgggttactactaagtttggcttttaatgaaagcattgtgatttttcttttactttggcaatttaatttggttcatggca |
6329685 |
T |
|
| Q |
222 |
gagcatcactccaatttttaaagttcatgatgacacagtaaagacaacaaatatgagccctagatcaacaaaacacaa |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6329686 |
gagcatcactccaatttttaaagttcatgatgacacagtaaagacaacaaatatgagccctagatcaacaaaacacaa |
6329763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 251
Target Start/End: Complemental strand, 49072747 - 49072686
Alignment:
| Q |
190 |
tttactttggcaatttaatttggttcatggcagagcatcactccaatttttaaagttcatga |
251 |
Q |
| |
|
|||||||| |||| ||||||||| ||||| |||||||||||||| ||||||| ||| |||| |
|
|
| T |
49072747 |
tttacttttgcaaattaatttggctcatgaaagagcatcactccactttttaaggtttatga |
49072686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University