View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15504_high_3 (Length: 484)
Name: NF15504_high_3
Description: NF15504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15504_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 241 - 466
Target Start/End: Original strand, 7969180 - 7969405
Alignment:
| Q |
241 |
tccttaatagaacataaatcttatacagctcaagacaaaacagaaaaaacaataatgtattatttctctacttatagggagattgtcttcatgacaaggg |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7969180 |
tccttaatagaacataaatcttatacagctcaagacaaaacagaaaaaacagtaatgtattatttctctacttatagggagattgtcttcatgacaaggg |
7969279 |
T |
|
| Q |
341 |
ttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggc |
440 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7969280 |
ttgccgacagtggcagatgatgaggtggatgattgcctgcttttggatttagtaattggtgatgatggcgcagtggtcatctagtctccgatgaggcggc |
7969379 |
T |
|
| Q |
441 |
tgacgaggtggagggttgacctctct |
466 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7969380 |
tgacgaggtggagggttgacctctct |
7969405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 290 - 399
Target Start/End: Complemental strand, 37577873 - 37577764
Alignment:
| Q |
290 |
caataatgtattatttctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatt |
389 |
Q |
| |
|
||||||||||| | ||||| ||||||| || ||||||||||||||||||||| || || |||||||| |||||||||| | |||| ||||||||||| |
|
|
| T |
37577873 |
caataatgtatgacttctcaacttatatggtgattgtcttcatgacaagggtcaccaacggcggcagacaatgaggtggacggttgcatgctcttggatg |
37577774 |
T |
|
| Q |
390 |
tagtaatcgg |
399 |
Q |
| |
|
|| ||||||| |
|
|
| T |
37577773 |
tattaatcgg |
37577764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 357 - 426
Target Start/End: Complemental strand, 32895287 - 32895222
Alignment:
| Q |
357 |
atgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtc |
426 |
Q |
| |
|
||||| ||||||||| |||||||||||||||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
32895287 |
atgataaggtggatggttgcctgctcttggatgtagtaat-ggtgatga---cgcagtggtcatctagtc |
32895222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 5e-23; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 305 - 434
Target Start/End: Original strand, 32651175 - 32651301
Alignment:
| Q |
305 |
tctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatg |
404 |
Q |
| |
|
||||||||||||||| || ||||||| ||| || ||||||||| || ||||||||||||||||| | ||| || ||||||||| |||||||||| | |
|
|
| T |
32651175 |
tctctacttatagggtgactgtcttcgtgataacggttgccgatggcagcagatgatgaggtggacggttgacttctcttggatatagtaatcgg---cg |
32651271 |
T |
|
| Q |
405 |
atggtgcagtggtcatctagtctccgatga |
434 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |
|
|
| T |
32651272 |
atggtgcagtggtcatctagtccccgatga |
32651301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 290 - 397
Target Start/End: Complemental strand, 25470117 - 25470010
Alignment:
| Q |
290 |
caataatgtattatttctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatt |
389 |
Q |
| |
|
||||||| ||||| || ||||||||||||| |||||||||||||| | ||| ||||| || || ||||||||||| |||| |||||||||||||||| |
|
|
| T |
25470117 |
caataatatattaattttctacttatagggtgattgtcttcatgatacaggtcgccgatggcagcggatgatgaggttgatggttgcctgctcttggatg |
25470018 |
T |
|
| Q |
390 |
tagtaatc |
397 |
Q |
| |
|
|||||||| |
|
|
| T |
25470017 |
tagtaatc |
25470010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 357 - 460
Target Start/End: Complemental strand, 32740694 - 32740594
Alignment:
| Q |
357 |
atgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggctgacgaggtggagggt |
456 |
Q |
| |
|
||||| ||||||| |||||| ||||||||| ||||||||||||||| || || |||||||||||||||| | ||||||| ||||||||||||||| |
|
|
| T |
32740694 |
atgataaggtggacaattgccaactcttggatgtagtaatcggtgatggtgttg---tggtcatctagtctccaaggaggcggaggacgaggtggagggt |
32740598 |
T |
|
| Q |
457 |
tgac |
460 |
Q |
| |
|
|||| |
|
|
| T |
32740597 |
tgac |
32740594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 290 - 385
Target Start/End: Complemental strand, 32768662 - 32768567
Alignment:
| Q |
290 |
caataatgtattatttctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttg |
385 |
Q |
| |
|
||||||||||||| || |||||||||||| | |||||||||||| |||||| ||||| |||||| | ||||||||||| | |||||||||||| |
|
|
| T |
32768662 |
caataatgtattactttactacttatagggtgtttgtcttcatgataagggtccccgacggcggcaaacgatgaggtggacggctgcctgctcttg |
32768567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 291 - 369
Target Start/End: Complemental strand, 28475529 - 28475450
Alignment:
| Q |
291 |
aataatgtattatttctctacttatagggag-attgtcttcatgacaagggttgccgacagcggcagatgatgaggtgga |
369 |
Q |
| |
|
||||||| || | |||||||| ||||||| | |||||||||| || |||||||||||||||||| || ||||||||||| |
|
|
| T |
28475529 |
aataatgcatgacttctctacatatagggtggattgtcttcacgataagggttgccgacagcggtggacgatgaggtgga |
28475450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 290 - 341
Target Start/End: Original strand, 2166106 - 2166159
Alignment:
| Q |
290 |
caataatgtat--tatttctctacttatagggagattgtcttcatgacaagggt |
341 |
Q |
| |
|
||||||||||| ||| |||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
2166106 |
caataatgtatgatatctctctagttataaggagattgtcttcatgacaagggt |
2166159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University