View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15504_high_3 (Length: 484)

Name: NF15504_high_3
Description: NF15504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15504_high_3
NF15504_high_3
[»] chr7 (3 HSPs)
chr7 (241-466)||(7969180-7969405)
chr7 (290-399)||(37577764-37577873)
chr7 (357-426)||(32895222-32895287)
[»] chr5 (5 HSPs)
chr5 (305-434)||(32651175-32651301)
chr5 (290-397)||(25470010-25470117)
chr5 (357-460)||(32740594-32740694)
chr5 (290-385)||(32768567-32768662)
chr5 (291-369)||(28475450-28475529)
[»] chr4 (1 HSPs)
chr4 (290-341)||(2166106-2166159)


Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 241 - 466
Target Start/End: Original strand, 7969180 - 7969405
Alignment:
241 tccttaatagaacataaatcttatacagctcaagacaaaacagaaaaaacaataatgtattatttctctacttatagggagattgtcttcatgacaaggg 340  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
7969180 tccttaatagaacataaatcttatacagctcaagacaaaacagaaaaaacagtaatgtattatttctctacttatagggagattgtcttcatgacaaggg 7969279  T
341 ttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggc 440  Q
    |||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||    
7969280 ttgccgacagtggcagatgatgaggtggatgattgcctgcttttggatttagtaattggtgatgatggcgcagtggtcatctagtctccgatgaggcggc 7969379  T
441 tgacgaggtggagggttgacctctct 466  Q
    ||||||||||||||||||||||||||    
7969380 tgacgaggtggagggttgacctctct 7969405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 290 - 399
Target Start/End: Complemental strand, 37577873 - 37577764
Alignment:
290 caataatgtattatttctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatt 389  Q
    ||||||||||| | ||||| ||||||| || |||||||||||||||||||||  || || ||||||||  |||||||||| | |||| |||||||||||     
37577873 caataatgtatgacttctcaacttatatggtgattgtcttcatgacaagggtcaccaacggcggcagacaatgaggtggacggttgcatgctcttggatg 37577774  T
390 tagtaatcgg 399  Q
    || |||||||    
37577773 tattaatcgg 37577764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 357 - 426
Target Start/End: Complemental strand, 32895287 - 32895222
Alignment:
357 atgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtc 426  Q
    ||||| ||||||||| |||||||||||||||| ||||||| ||||||||    |||||||||||||||||    
32895287 atgataaggtggatggttgcctgctcttggatgtagtaat-ggtgatga---cgcagtggtcatctagtc 32895222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 56; Significance: 5e-23; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 305 - 434
Target Start/End: Original strand, 32651175 - 32651301
Alignment:
305 tctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatttagtaatcggtgatg 404  Q
    ||||||||||||||| || ||||||| ||| || |||||||||  || ||||||||||||||||| | ||| || ||||||||| ||||||||||    |    
32651175 tctctacttatagggtgactgtcttcgtgataacggttgccgatggcagcagatgatgaggtggacggttgacttctcttggatatagtaatcgg---cg 32651271  T
405 atggtgcagtggtcatctagtctccgatga 434  Q
    |||||||||||||||||||||| |||||||    
32651272 atggtgcagtggtcatctagtccccgatga 32651301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 290 - 397
Target Start/End: Complemental strand, 25470117 - 25470010
Alignment:
290 caataatgtattatttctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttggatt 389  Q
    ||||||| ||||| || ||||||||||||| |||||||||||||| |  ||| |||||  || || ||||||||||| |||| ||||||||||||||||     
25470117 caataatatattaattttctacttatagggtgattgtcttcatgatacaggtcgccgatggcagcggatgatgaggttgatggttgcctgctcttggatg 25470018  T
390 tagtaatc 397  Q
    ||||||||    
25470017 tagtaatc 25470010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 357 - 460
Target Start/End: Complemental strand, 32740694 - 32740594
Alignment:
357 atgatgaggtggatgattgcctgctcttggatttagtaatcggtgatgatggtgcagtggtcatctagtctccgatgaggcggctgacgaggtggagggt 456  Q
    ||||| |||||||  ||||||  ||||||||| ||||||||||||||| || ||   |||||||||||||||| | |||||||  |||||||||||||||    
32740694 atgataaggtggacaattgccaactcttggatgtagtaatcggtgatggtgttg---tggtcatctagtctccaaggaggcggaggacgaggtggagggt 32740598  T
457 tgac 460  Q
    ||||    
32740597 tgac 32740594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 290 - 385
Target Start/End: Complemental strand, 32768662 - 32768567
Alignment:
290 caataatgtattatttctctacttatagggagattgtcttcatgacaagggttgccgacagcggcagatgatgaggtggatgattgcctgctcttg 385  Q
    ||||||||||||| ||  |||||||||||| | |||||||||||| ||||||  ||||| |||||| | ||||||||||| |  ||||||||||||    
32768662 caataatgtattactttactacttatagggtgtttgtcttcatgataagggtccccgacggcggcaaacgatgaggtggacggctgcctgctcttg 32768567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 291 - 369
Target Start/End: Complemental strand, 28475529 - 28475450
Alignment:
291 aataatgtattatttctctacttatagggag-attgtcttcatgacaagggttgccgacagcggcagatgatgaggtgga 369  Q
    ||||||| || | |||||||| ||||||| | |||||||||| || ||||||||||||||||||  || |||||||||||    
28475529 aataatgcatgacttctctacatatagggtggattgtcttcacgataagggttgccgacagcggtggacgatgaggtgga 28475450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 290 - 341
Target Start/End: Original strand, 2166106 - 2166159
Alignment:
290 caataatgtat--tatttctctacttatagggagattgtcttcatgacaagggt 341  Q
    |||||||||||  ||| |||||| ||||| ||||||||||||||||||||||||    
2166106 caataatgtatgatatctctctagttataaggagattgtcttcatgacaagggt 2166159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University