View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15504_high_7 (Length: 364)
Name: NF15504_high_7
Description: NF15504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15504_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 44993125 - 44992968
Alignment:
| Q |
1 |
ctatcatgcatagaagatatggcataaaataattgtcaactcatattctcatgacgtttagtgctttctagttggatacttatgcccatatgtccctgta |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44993125 |
ctatcatgcatagaagatatgccataaaataattgtcaactcatattctcatgacgtttagtgctttctagttggatacttatgcccatatgtccctgta |
44993026 |
T |
 |
| Q |
101 |
attaatatcatagactcataggatatgtaaaaatctaacttattttgctatcaaacta |
158 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44993025 |
attaatatcatagactcatagtatatgtaaaaatctaacttcttttgctatcaaacta |
44992968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 226 - 336
Target Start/End: Complemental strand, 44992901 - 44992791
Alignment:
| Q |
226 |
cccactttcatatgcttctcttttcctatttatattacattttgggacctttttgcttctggtagcttgttgtcgtcttattcctccactttccccatct |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44992901 |
cccactttcatatgcttctcttttcctatttatattacattttgggacctttttccttctggtagcttgttgtcgtcttattcctccactttccccatct |
44992802 |
T |
 |
| Q |
326 |
ttttggtttct |
336 |
Q |
| |
|
||||||||||| |
|
|
| T |
44992801 |
ttttggtttct |
44992791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University