View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15504_low_10 (Length: 307)
Name: NF15504_low_10
Description: NF15504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15504_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 31644265 - 31643980
Alignment:
| Q |
1 |
aattctttgttgaacttctttgtaccgcagtagcctaataagaccaaggttgtaggaccatcgttgacgggtttaggttagaactttccacgtaaatcat |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31644265 |
aattctttgttgaacttctttgcaccgcagtagcctaataagaccaaggttgtaggaccatcgttgacgggtttaggttagaactttccacgtaactcat |
31644166 |
T |
 |
| Q |
101 |
tggaaaaatcgttagacctttgtgcgagatagtaacagtagcatctcacactccaattataaaaggttgctctcattctcacccaatattggtgaaatca |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31644165 |
tggaaaa-tcgttagacctttgtgcgagatagtaacagtagcatctcacactccaattataaaaggttgctctcattctcacccaatattggtgaaatca |
31644067 |
T |
 |
| Q |
201 |
atttttacaaacttgagataaaatgacgtccattgttgttcaaatttggagatggttcttgcagcaaaaggtattgagatttgtggg |
287 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
31644066 |
atttttacaaacttgaaacaaaatgacgtccattgttgttcaaatttggagatggttcttgcagccaaaggtatggagatttgtggg |
31643980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University