View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15504_low_15 (Length: 210)
Name: NF15504_low_15
Description: NF15504
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15504_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 3e-50; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 67 - 195
Target Start/End: Complemental strand, 1684915 - 1684792
Alignment:
| Q |
67 |
attttagaatgttctgttttttctttcgatcacctaattaagttcatgatgtgttattattcgcataagttttatctttatacttaagagatgagatggt |
166 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1684915 |
attttcgaatgttctgttttttctttctatcacctaattaagttcatgatgtgttattattcgcataagttttatctttatacttaaga-----gatggt |
1684821 |
T |
 |
| Q |
167 |
tgtgtaaaatgataaatattgtcacttgt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1684820 |
tgtgtaaaatgataaatattgtcacttgt |
1684792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 53
Target Start/End: Complemental strand, 1684950 - 1684912
Alignment:
| Q |
15 |
gaagggtatgtatgctttcacactatgattatggcattt |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1684950 |
gaagggtatgtatgctttcacactatgattatggcattt |
1684912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 1971430 - 1971390
Alignment:
| Q |
15 |
gaagggtatgtatgctttcacactatgattatggcatttat |
55 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
1971430 |
gaagggtacgtatgctttcacactatgattatggtatttat |
1971390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 73 - 106
Target Start/End: Complemental strand, 1695235 - 1695202
Alignment:
| Q |
73 |
gaatgttctgttttttctttcgatcacctaatta |
106 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
1695235 |
gaatgttctgttttttctttcgattacctaatta |
1695202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University