View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15505_low_7 (Length: 233)
Name: NF15505_low_7
Description: NF15505
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15505_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 37801789 - 37801590
Alignment:
| Q |
1 |
aatatggcacaatagtttaattcgaaaagtttgactcttctctaccatttatcatttatttgactgttccctcaattttctaaagcttccttgctcattg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37801789 |
aatatggcacaatagtttaattcgaaaagtttgactcttct--accatttatcatttatttgactgttccctcaattttctaaagcttccttgctcattg |
37801692 |
T |
|
| Q |
101 |
aagattgaaggaagactcactcaaagagctatgatcaatacaaggaagccatggttctgtctttctcttcttggcctcatcttctctttacacttccatc |
200 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
37801691 |
aagattga------------------agccatgatcaatacaaggaagccatggttctgtctttctcttcttgtcctcatcttctttttacacttccatc |
37801610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 149 - 220
Target Start/End: Original strand, 37764091 - 37764162
Alignment:
| Q |
149 |
ccatggttctgtctttctcttcttggcctcatcttctctttacacttccatcattcccttgcagctctaact |
220 |
Q |
| |
|
||||||||||| |||||| |||| |||| |||||| |||||||| | ||| ||||||||||||||||||| |
|
|
| T |
37764091 |
ccatggttctggctttctgttctaaacctcttcttctatttacactactatccttcccttgcagctctaact |
37764162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University