View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15507_high_5 (Length: 414)
Name: NF15507_high_5
Description: NF15507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15507_high_5 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 359; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 359; E-Value: 0
Query Start/End: Original strand, 18 - 414
Target Start/End: Complemental strand, 23817408 - 23817016
Alignment:
| Q |
18 |
aatgggacgaaggaaggtgagtatggtgattatttgttgtaacataacatcacattcatttatgacttgttatgggaatagaagcatggtgtaactgtaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23817408 |
aatgggacgaaggaaggtgagtatggtgattatttgttgtaacataacatcacattcatttatgacttgttatgggaatagaagcatggtgtaactgtaa |
23817309 |
T |
 |
| Q |
118 |
tggaccccgttttgtttgttttgtttggaattgaatcttgccattctgcagctgcaaagtggaatggaaacccctttttacaaaatccatggtttgcaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23817308 |
tggaccccgttttgtttgttttgtttggaattgaatcttgccattctgcagctgcaaagtggaatggaaacccctttttacaaaatccatggtttgcaac |
23817209 |
T |
 |
| Q |
218 |
aaacatgaattttgttgttgacatcgccacatttgttttcagctagcttctcttagtcctactatagacatagacaaggactagtagtagtaaataggct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
23817208 |
aaacatgaattttgttgttgacatcgccacatttgttttcagctagcttctcttagtcctactatag-catagacaaggac---tagtagtaaataggct |
23817113 |
T |
 |
| Q |
318 |
ctatcaagataaagagattgcggctaggaatttcagctgtctgatctcaaattaacagttgagattgtttaaaaagaattgaccgacggtgtaatct |
414 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
23817112 |
ctatcaagataaagagattgcggctaggtatttcagctgtctgatctcaaattaaccgttgagattgtttaaaaataattgactgacggtgtaatct |
23817016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 85 - 147
Target Start/End: Complemental strand, 23826812 - 23826752
Alignment:
| Q |
85 |
tgttatgggaatagaagcatggtgtaactgtaatggaccccgttttgtttgttttgtttggaa |
147 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| ||| |||||||||||||||| |
|
|
| T |
23826812 |
tgttatgggaacagaagcatggtgtaactgtaagggacccc--tttttttgttttgtttggaa |
23826752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 354 - 387
Target Start/End: Original strand, 33554275 - 33554308
Alignment:
| Q |
354 |
ctgtctgatctcaaattaacagttgagattgttt |
387 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
33554275 |
ctgtccgatctcaaattaacagttgagattgttt |
33554308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University