View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15507_low_6 (Length: 375)
Name: NF15507_low_6
Description: NF15507
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15507_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 19 - 175
Target Start/End: Complemental strand, 43697900 - 43697752
Alignment:
| Q |
19 |
cttatatgagctcactcctgttcatatataagtgcaaagagtcagtcaattaaaatactaagcaaattaacaaaatagccccatgtctataccatgccac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
43697900 |
cttatatgagctcactcctgttcatatataagtgcaaagagtca----attaaaatactaagcaaa----caaaatatccccatgtctataccatgccac |
43697809 |
T |
|
| Q |
119 |
attttgatactatatctcataagttgggaggtgtgggcaacctataagcttttatca |
175 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43697808 |
attttgatactatatctcataagatgggaggtgtgggcaacctataagcttttatca |
43697752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 241 - 359
Target Start/End: Complemental strand, 43697632 - 43697514
Alignment:
| Q |
241 |
tgaactattagattatgtatatgcaaagaaattgcaaatactgaccttcaagctttgatatatgtttctcaacttttcttgcacagccatggcaatgcat |
340 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43697632 |
tgaactattagattatgtatatgtaaagaaattccaaatactcaccttcaagctttgatatatgtttctcaacttttcttgcacagccatggcaatgcat |
43697533 |
T |
|
| Q |
341 |
ggaaaccctcaatattacc |
359 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
43697532 |
ggaaaccctcaatattacc |
43697514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 294 - 355
Target Start/End: Original strand, 32212633 - 32212694
Alignment:
| Q |
294 |
tttgatatatgtttctcaacttttcttgcacagccatggcaatgcatggaaaccctcaatat |
355 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| |||||||| || ||||||||||| |
|
|
| T |
32212633 |
tttgagatatgtttctcaacttttcttgcacatccatgacaatgcattgacaccctcaatat |
32212694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University