View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15508_low_17 (Length: 219)

Name: NF15508_low_17
Description: NF15508
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15508_low_17
NF15508_low_17
[»] chr4 (1 HSPs)
chr4 (13-200)||(4158878-4159065)


Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 200
Target Start/End: Original strand, 4158878 - 4159065
Alignment:
13 caaaggttaacacggcaataccnnnnnnngttcatagagtgaaaaataaaggatgatcatgaattcacgactcaaaaggttttgcttatttatggattct 112  Q
    ||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4158878 caaaggttaacacggcaataccaaaaaaagttcatagagtgaaaaataaaggatgatcatgaattcacgactcaaaaggttttgcttatttatggattct 4158977  T
113 gtccctttatgccttcttttttacttgctaactaggctttatttgtcaataaattcaaactgaaaggttatacattagcaaacaagtt 200  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4158978 gtccctatatgccttcttttttacttgctaactaggctttatttgtcaataaattcaaactgaaaggttatacattagcaaacaagtt 4159065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University