View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15509_high_5 (Length: 250)
Name: NF15509_high_5
Description: NF15509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15509_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 95 - 229
Target Start/End: Complemental strand, 3134349 - 3134216
Alignment:
| Q |
95 |
taggtaattagtatgtgttgaatgaaaatgatgaaaatttcaactgaagatattcaaatcaaatcaaatagataatatgccaacgattgtcgattttgct |
194 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3134349 |
taggtaatt-gtatgtgttgaataaaaatgatgaaaatttcaactgaagatattcaaatcaaatcaaatagataatatgccaacgattgtcgattttgct |
3134251 |
T |
 |
| Q |
195 |
cttctctaaggcaaactcccgattttaacaacctt |
229 |
Q |
| |
|
| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
3134250 |
catctctgaggcaaactcccgattttaacaacctt |
3134216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 3134396 - 3134341
Alignment:
| Q |
1 |
ttgtacaaaatcaagattcaaaaagaaaattgcgagaagaaagaatataggtaatt |
56 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3134396 |
ttgtacaaaatcaagattgaaaaagaaaattgcgagaagaaagaatataggtaatt |
3134341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University