View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15509_low_9 (Length: 237)
Name: NF15509_low_9
Description: NF15509
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15509_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 19162949 - 19163165
Alignment:
| Q |
18 |
tttgttaaaaaacaacgaaacaaatataaattcttcaaaactgaactggtatttcttttctcatgtttttgttgattcaatactgataagatcacaaact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19162949 |
tttgttaaaaaacaacgaaacaaatataaattcttcaaaactcaactggtatttcttttctcatgtttttgttgattcaataccgataagatcacaaact |
19163048 |
T |
 |
| Q |
118 |
caacagtaagcgattttcaagcgtcgattttaagaattttttatacttatatttgctttaattatgtgaatgcaggagctaccagataacatctttgctt |
217 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19163049 |
caacagtaagctattttcaagcatcgattttaagaattttttatacttatatttgctttaattatgtgaatgcaggagctaccagataacgtctttgctt |
19163148 |
T |
 |
| Q |
218 |
tattgatgatgtccatc |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
19163149 |
tattgatgatgtccatc |
19163165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University