View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1550_high_11 (Length: 235)
Name: NF1550_high_11
Description: NF1550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1550_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 48331906 - 48331689
Alignment:
| Q |
1 |
cctttcttaattatgaaaatcattcattttagcataacataatgttttaagtacatgttaacattatttatttgcaagctatgcactcttatcttttgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48331906 |
cctttcttaattatgaaaatcattcattttagcataacataatgttttaagtacatgtcaacactatttatttgcaagctatgcactcttattttttgtc |
48331807 |
T |
 |
| Q |
101 |
tggtatcactgtaatttttatattttaatgactagagtttggtcgtttcactaattggaaactttgttttggtgtattttacaggaagtggccgcagccc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48331806 |
tggtatcactgtaatttttatattttaatgactagagtttggtcgtttcgctaattggaaactttgttttggtgtattttacaggaagtggccgcagccc |
48331707 |
T |
 |
| Q |
201 |
ggctacaattggattcct |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48331706 |
ggctacaattggattcct |
48331689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University