View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1550_high_5 (Length: 279)
Name: NF1550_high_5
Description: NF1550
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1550_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 8 - 266
Target Start/End: Original strand, 32836467 - 32836718
Alignment:
| Q |
8 |
agagaagaatgtgtcgcagaatatcaaatctagtgggttatactaaaacagtgaaggttgcacatattctgtggacagaacagaagtgtacgaccatcgc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
32836467 |
agagaagaatgtgtcgcagaatatcaaatctcacg--ttatactaaaacagtgaaggttgcacatattctgtggacag-----aagtgtaccaccatcgc |
32836559 |
T |
|
| Q |
108 |
agcaacatgcagaattctagtaaagaatgacatgagatattcaagaacataaatatactttgacattgacactgaattatatcaccctacaaatgcaagc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32836560 |
agcaacatgcagaattctagtaaagaatgacatgagatattcaagaacataaatatactttgacattgacactgaattatatcaccctacaaatgcaagc |
32836659 |
T |
|
| Q |
208 |
actaccaacttcaggtcgaaaaaggacatcaatatctcattaataaaaacaaagttttt |
266 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32836660 |
actaccaacttctggtcgaaaaaggacatcaatatctcattaacgaaaacaaagttttt |
32836718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 45441713 - 45441763
Alignment:
| Q |
184 |
ttatatcaccctacaaatgcaagcactaccaacttcaggtcgaaaaaggac |
234 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45441713 |
ttatatcaccctacaaatgcaagcactgccaacttcaggtcgaaaaaggac |
45441763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University