View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15512_high_5 (Length: 344)
Name: NF15512_high_5
Description: NF15512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15512_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 54 - 331
Target Start/End: Complemental strand, 46322599 - 46322322
Alignment:
| Q |
54 |
ctcaggcaggcaaagcgtgtgattagacccttgacaccaaaacaaggtggttacagacacggtttcagttcattaattacttactgaagcatataagcga |
153 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46322599 |
ctcaggcaggcaaagtgtgtgattagacccttgacaccaaaacaaggtggttacagacacggtttcagttcattaattacttattgaagcatataagcga |
46322500 |
T |
 |
| Q |
154 |
aagaacatacacatcgctagatgttactgcagcaccaatttctaattgtttaccaaacaaatcgaatttacataaattagtggttttgagatgcattagt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46322499 |
aagaacatacacatcgctagatgttactgcagcaccaatttctaattgtttaccaaacaaatcgaatttacataaattagtggttttgagatgcattagt |
46322400 |
T |
 |
| Q |
254 |
gcttcagaactggatgcatcagcagtcgatgtactaaaggtgatgtgccatggcatgacacccgtcaaaattttattc |
331 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46322399 |
gcttcagaactggaagcatcagcagtcaatgtactaaaggtgatgtgccatggcatgacacccgtcaaaattttattc |
46322322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University