View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15512_low_1 (Length: 819)
Name: NF15512_low_1
Description: NF15512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15512_low_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 96; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 705 - 804
Target Start/End: Original strand, 41608267 - 41608366
Alignment:
| Q |
705 |
aaaacttaacactttgtacccttaaaataaaattcgagaggcactcgctttgctaagagtgtcataaggatgtatgttagaaaattcaaaagtgataatt |
804 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41608267 |
aaaacttaacactttgtacccttaaaataaaattcgagaggcactcgctttgctaagagtgtcataaggatgtatgttagaaaactcaaaagtgataatt |
41608366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University