View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15512_low_1 (Length: 819)

Name: NF15512_low_1
Description: NF15512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15512_low_1
NF15512_low_1
[»] chr4 (1 HSPs)
chr4 (705-804)||(41608267-41608366)


Alignment Details
Target: chr4 (Bit Score: 96; Significance: 1e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 1e-46
Query Start/End: Original strand, 705 - 804
Target Start/End: Original strand, 41608267 - 41608366
Alignment:
705 aaaacttaacactttgtacccttaaaataaaattcgagaggcactcgctttgctaagagtgtcataaggatgtatgttagaaaattcaaaagtgataatt 804  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
41608267 aaaacttaacactttgtacccttaaaataaaattcgagaggcactcgctttgctaagagtgtcataaggatgtatgttagaaaactcaaaagtgataatt 41608366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University