View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15512_low_10 (Length: 346)
Name: NF15512_low_10
Description: NF15512
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15512_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 329
Target Start/End: Original strand, 26436748 - 26437073
Alignment:
| Q |
1 |
attaataatattagatttcaaaaatatttgtttggtataactgtgcaagtttatgttttatacttgaccacttttctccttttaaacattgatggccttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26436748 |
attaataatattagatttcaaaaatatttatttggtataactgtgcaagtttatgttttatacttgaccactattctccttttaaacattgatggccttt |
26436847 |
T |
|
| Q |
101 |
gtagcatacacttttgcttgaaggtgaggttggtgtttggtggtattggcatgtgattgtgttcaattatgtcannnnnnnaaattacaatcgatgttgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26436848 |
gtagcatacacttttgcttgaaggtgaggttggtgtt---tggtattggcatgtgattgtgttcaattatgtcatttttttaaattacaatcgatgttgt |
26436944 |
T |
|
| Q |
201 |
gttgaagtgtgcgtgttgtgccggtgcttgtgttattgtttcatagttgaagagacatgtttagccctttaaagagatggaactgagctgctacctgaag |
300 |
Q |
| |
|
|| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||| |
|
|
| T |
26436945 |
gtcgaagtgtgtgtgttgtgccggtgcttgtgttattgtttcatagttgaagagacatgtttagccctttaaagagatgaaactgagttgctagctgaag |
26437044 |
T |
|
| Q |
301 |
cgtgcaaatgaatggacatattatgttgt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26437045 |
cgtgcaaatgaatggacatattatgttgt |
26437073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 3 - 62
Target Start/End: Original strand, 31633269 - 31633328
Alignment:
| Q |
3 |
taataatattagatttcaaaaatatttgtttggtataactgtgcaagtttatgttttata |
62 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
31633269 |
taataatatgggatttcaaaagtatttgtttggtataactgggcaagtatatgttttata |
31633328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University