View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15513_high_16 (Length: 247)
Name: NF15513_high_16
Description: NF15513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15513_high_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 53123903 - 53123675
Alignment:
| Q |
19 |
gtgattatgttgcgttttacacttctttttcacttgcaagggaatcgttggcatttcagccactcgttcatttttgcacataacactgcaatgccatgga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53123903 |
gtgattatgttgcgttttacacttctttttcacttgcaagggaatcgttggcatttcagccactcgttcatttttgcacataacactgcaatgccatgga |
53123804 |
T |
 |
| Q |
119 |
aggttgagtaaacacatccattaagcctccattaccatcacattcacagtacaaggttggtcctgggaagatcattctcagcatagttttaggaacagtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53123803 |
aggttgagtaaacacatccattaagcctccattaccatcacattcacagtacaaggttggtcctgggaagatcattctcagcatagttttaggaacagtc |
53123704 |
T |
 |
| Q |
219 |
actggactaattggttctgtaatctttca |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53123703 |
actggactaattggttctgtaatctttca |
53123675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 238
Target Start/End: Complemental strand, 6505267 - 6505195
Alignment:
| Q |
166 |
agtacaaggttggtcctgggaagatcattctcagcatagttttaggaacagtcactggactaattggttctgt |
238 |
Q |
| |
|
|||| |||| || |||| ||||||| ||| | ||||||||||||||| | || |||||| ||||||||||||| |
|
|
| T |
6505267 |
agtataaggatgatcctaggaagattattattagcatagttttaggagctgttactggattaattggttctgt |
6505195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University