View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15513_high_23 (Length: 208)
Name: NF15513_high_23
Description: NF15513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15513_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 167
Target Start/End: Original strand, 38883312 - 38883461
Alignment:
| Q |
18 |
ttattatccatgttggtgttctgcaacagcattatgtcctttgtggcaacatcatcagtttgcacactctccatccccctaaaggttttcagttggaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
38883312 |
ttattatccatgttggtgttctgcaacagcattacgtcctttgtggcaacatcatcagtttgcatactctccatccccctaaaggttttcagttggaaat |
38883411 |
T |
 |
| Q |
118 |
ctatgctagcattgtggtcattgtctttctacctgttaagttgcttcttg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38883412 |
ctatgctagcattgtggtcattgtctttctacctgttaagttgcttcttg |
38883461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University