View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15513_low_15 (Length: 339)
Name: NF15513_low_15
Description: NF15513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15513_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 102 - 321
Target Start/End: Complemental strand, 24232518 - 24232299
Alignment:
| Q |
102 |
gccccaccggtcctagcactggccatgttttggagattctaaatttggtaacacagtttactgtacaaacatccctgtcctgtaccatttcctcagccag |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24232518 |
gccccaccggtcctagcactggccatgttttggagattctaaatttggtaacacagtttactgtacaaacatccctgtcctgtaccgtttcctcagccag |
24232419 |
T |
|
| Q |
202 |
ttgaagtttttgcctacttccatcctgttgtgcacattcatcgtgcttcatccggttcttctacatcaagttgtgattcgaccagttgtgccttctccac |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
24232418 |
ttgaagtttttgcctacttccatcctgttgtgcacattcatcgtgcttcatccggttcttctacatcaagttgtgattcaaccagttgtgccttctccac |
24232319 |
T |
|
| Q |
302 |
tgagaccagttccagacaac |
321 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24232318 |
tgagaccagttccagacaac |
24232299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University