View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15513_low_20 (Length: 287)

Name: NF15513_low_20
Description: NF15513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15513_low_20
NF15513_low_20
[»] chr5 (1 HSPs)
chr5 (1-276)||(32461880-32462157)


Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 32462157 - 32461880
Alignment:
1 tgatatttatgattcaaacctaatgatcttaggatgacaattgagtcccgttgcccatcactcacattcaattataaattcttctattacatagaaaaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||    
32462157 tgatatttatgattcaaacctaatgatcttaggatgacaattgagtcccgttgcccatcactcacattcaattataaattcatctaatacatagaaaaat 32462058  T
101 tgttaatgggttggatctaatccatccatccaacaattttttcattatgatatgtaaatcgctattagaaaattttaaattatagacaggctaaatcaat 200  Q
    |||||||||||||||||||||||||||||| ||||||| |||  ||||||||| || |||||||||| |||| ||||||||||| || || ||||||| |    
32462057 tgttaatgggttggatctaatccatccatctaacaattattttgttatgatatttagatcgctattaaaaaaatttaaattataaacgggttaaatcagt 32461958  T
201 ttctaaaatgcaaaaaccctgtctcttatcac--gatagagacaaaattaggtccaaataaattttatcgtatttcat 276  Q
     | |||||||| ||||  | ||||||||||||  |||||||| |||||||| ||||||||||||||||||||||||||    
32461957 ctttaaaatgctaaaaatccgtctcttatcacgagatagagataaaattagatccaaataaattttatcgtatttcat 32461880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University