View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15513_low_25 (Length: 245)
Name: NF15513_low_25
Description: NF15513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15513_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 117 - 229
Target Start/End: Original strand, 53018185 - 53018295
Alignment:
| Q |
117 |
agtggaaagagcggcaggagtattaccagaagaaaaaagttgtctcaaaagagactcaataatttgtgacagacccaatggagtcgggatgagattgatt |
216 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
53018185 |
agtggaaagagcggcaggagcattatcagaagaaaaaagttgtctcaaaagagactcaataatttgtgac--acccaatggagtcaggatgagattgatt |
53018282 |
T |
|
| Q |
217 |
ccgattttgatca |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
53018283 |
ccgattttgatca |
53018295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 16 - 86
Target Start/End: Original strand, 53008022 - 53008090
Alignment:
| Q |
16 |
taggccattactctggacttgacaaagacacactacagactccactcatattaaaatcttaatttagaatg |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
53008022 |
taggccattactctggacttgacaaagacacgctacagactccactc--attaaaatcttaatttagaatg |
53008090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 100 - 176
Target Start/End: Complemental strand, 16502083 - 16502007
Alignment:
| Q |
100 |
ttagaattacatggtgtagtggaaagagcggcaggagtattaccagaagaaaaaagttgtctcaaaagagactcaat |
176 |
Q |
| |
|
|||||||||| |||||| || ||||||||||| ||||||||||||||| || ||||||||| | |||||||||||| |
|
|
| T |
16502083 |
ttagaattacctggtgtggtagaaagagcggccagagtattaccagaaggaagaagttgtctgagaagagactcaat |
16502007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University