View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15513_low_29 (Length: 229)
Name: NF15513_low_29
Description: NF15513
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15513_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 12640975 - 12641196
Alignment:
| Q |
1 |
cttggttaaggagtctggtaaccagttttcatagagttgtgtcatccctcaacaaaacctaaatgaatatgtttccctaggaagtcgtcagttgtcgcaa |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12640975 |
cttggttaaggagtcttgtaaccagttttcatagagttgtgtcatccctcaacaaaacctaaatgaatatgtttccgtaggaagtcgtcagttgtcgcaa |
12641074 |
T |
 |
| Q |
101 |
caacaagaatcgtaccgggattgtttgtgcaaaatcattcaaagcaactatactacttgttttacactagccattttctttttatcaaacaagaaaataa |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12641075 |
caacaagaatcgtagcgggattgtttgtgcaaaatcattcaaagcaactatactacttgttttacactagccattttctttttatcaaacaagaaaataa |
12641174 |
T |
 |
| Q |
201 |
aagaacgaagaaaatacatact |
222 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
12641175 |
aagaatgaagaaaatacatact |
12641196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University