View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15514_low_21 (Length: 326)
Name: NF15514_low_21
Description: NF15514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15514_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 15 - 308
Target Start/End: Complemental strand, 33378030 - 33377736
Alignment:
| Q |
15 |
gagaggctaatcttgtagctaatgttaaacaagctatcgttgttcaagattccagcatcaaattcacttcttgagaaggaaacggaagatgtagatacgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33378030 |
gagaggctaatcttgtagctaatgttaaacaagctatcgttgttcaagattccagcatcaaattcacttcttgagatggaaacggaagatgtagatacgt |
33377931 |
T |
 |
| Q |
115 |
actcatcatcaacaaataagggagacgaagagccccaagctacnnnnnnnn-ggactctctaatcgacatatcaaatttcatgtcatatgaatatgcatc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33377930 |
actcatcatcaacaaataagggagacgaagagccccaagctactttttttttggactctctaatcgacatatcaaatttcatgtcatatgaatatgcatc |
33377831 |
T |
 |
| Q |
214 |
tgggtaccttttcccttggttctcaataactttgtgtggtggacatgattgattaactctatcaagttggctatattcataccttaagtctttac |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33377830 |
tgggtaccttttcccttggttctcaataactttgtgtggtggacatgattgattaactctatcaagttggctatattcataccttaagtctttac |
33377736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University