View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15514_low_34 (Length: 238)
Name: NF15514_low_34
Description: NF15514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15514_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 6 - 222
Target Start/End: Complemental strand, 15303949 - 15303734
Alignment:
| Q |
6 |
tttatttatgcttttctcatcaaattattccactccctttaggttacattatcattgacgtaatcaaacacgccgatttctctgaatgcttatacggttt |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
15303949 |
tttatttatgcttttctcatcaaattattccactccctttaggttacatgatcattgacatgatcaaacacaccgatttctctgaatgcttatacgattt |
15303850 |
T |
 |
| Q |
106 |
aggggtacgtatatatatcacttctggttatatgcttcaattgttgcattcttttccttttgaacgaacactgttactgttattttctttgtttttcttg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||||||||| |
|
|
| T |
15303849 |
aggggtacgtatatatatcacttctggttatatgcttcaattgttgcattcttttccttttgaactaa-actaacactgttattttctttgtttttcttg |
15303751 |
T |
 |
| Q |
206 |
ttttagatgtgtgctaa |
222 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
15303750 |
tcttagatgtgtgctaa |
15303734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University