View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15514_low_37 (Length: 237)
Name: NF15514_low_37
Description: NF15514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15514_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 41926982 - 41927121
Alignment:
| Q |
1 |
ttctgttcctttcttgtttgctcaaaatgcatgtcagttgagttgcatagattctttgtacttaatttcacaaaatacatgtggagaagaaacttgatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41926982 |
ttctgttcctttcttgtttgctcaaaatgcatgtcagttgagttgcatagattctttgtacttaatttcacaaaatacatgtgg---agaaacttgatgg |
41927078 |
T |
|
| Q |
101 |
cacttgaatcccgaattgatagtggaaattgaatataagcttg |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41927079 |
cacttgaatcccgaattgatagtggaaattgaatataagcttg |
41927121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 36122298 - 36122209
Alignment:
| Q |
1 |
ttctgttcctttcttgtttgctcaaaatgcatgtcagttgagttgcatagattctttgtacttaatttcacaaa-atacatgtggagaag |
89 |
Q |
| |
|
|||| ||||||| |||||||||||||||| ||| ||||| ||||||||||| ||||||| |||||||||| ||| ||||||||||||||| |
|
|
| T |
36122298 |
ttctcttccttttttgtttgctcaaaatgtatgccagttaagttgcatagactctttgtgcttaatttcagaaacatacatgtggagaag |
36122209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University