View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15514_low_39 (Length: 228)
Name: NF15514_low_39
Description: NF15514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15514_low_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 14909035 - 14908828
Alignment:
| Q |
1 |
tacactaatttttctttcatatcatatcgaatcaatcaagttaattctannnnnnnnctggctcgaacgatagtaaattttaagcatattttattttgct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14909035 |
tacactaatttttctttcatatcatatcgaatcaatcaagttaattctattttttttctggctcgaacgatagtaaattttaagcatattttattttgct |
14908936 |
T |
|
| Q |
101 |
actaagtttttgagcataatctattttaaagctgtc-----nnnnnnnnnnnnnggtttaattgtaaatttggcctcttaattttttaaaacttgcaatt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14908935 |
actaagtttttgagcataatctattttaaagttgtcttctttttttttttttttggtttaattgtaaatttggcctcttaactttttaaaacttgcaatt |
14908836 |
T |
|
| Q |
196 |
ttgatctc |
203 |
Q |
| |
|
|||||||| |
|
|
| T |
14908835 |
ttgatctc |
14908828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University