View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15514_low_42 (Length: 222)

Name: NF15514_low_42
Description: NF15514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15514_low_42
NF15514_low_42
[»] chr4 (2 HSPs)
chr4 (1-185)||(35796059-35796243)
chr4 (180-222)||(35796256-35796298)


Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 35796059 - 35796243
Alignment:
1 gtacttagttccactatacctcataatgggtagaaattttaggaaaagtagataggatgagagaagagcaccctacctggcaacaactttaattatatct 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35796059 gtacttggttccactatacctcataatgggtagaaattttaggaaaagtagataggatgagagaagagcaccctacctggcaacaactttaattatatct 35796158  T
101 ctctagccccctttttgaatttgcttggctgaagatgctgtctgactttttgtcattgattttaggtatagcctctagaccatat 185  Q
    ||||||| ||||||||||||||| ||||||||||||||||| |||| ||||||||| ||||||||||||||| ||||||||||||    
35796159 ctctagctccctttttgaatttggttggctgaagatgctgtatgacgttttgtcatggattttaggtatagcttctagaccatat 35796243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 35796298 - 35796256
Alignment:
180 ccatatcatcattgacagttatatttccactgatcagtaatgt 222  Q
    |||||||||||||||||||||||||||||||||||||||||||    
35796298 ccatatcatcattgacagttatatttccactgatcagtaatgt 35796256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University