View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15514_low_42 (Length: 222)
Name: NF15514_low_42
Description: NF15514
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15514_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 35796059 - 35796243
Alignment:
| Q |
1 |
gtacttagttccactatacctcataatgggtagaaattttaggaaaagtagataggatgagagaagagcaccctacctggcaacaactttaattatatct |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35796059 |
gtacttggttccactatacctcataatgggtagaaattttaggaaaagtagataggatgagagaagagcaccctacctggcaacaactttaattatatct |
35796158 |
T |
 |
| Q |
101 |
ctctagccccctttttgaatttgcttggctgaagatgctgtctgactttttgtcattgattttaggtatagcctctagaccatat |
185 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||| |||| ||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
35796159 |
ctctagctccctttttgaatttggttggctgaagatgctgtatgacgttttgtcatggattttaggtatagcttctagaccatat |
35796243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 222
Target Start/End: Complemental strand, 35796298 - 35796256
Alignment:
| Q |
180 |
ccatatcatcattgacagttatatttccactgatcagtaatgt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35796298 |
ccatatcatcattgacagttatatttccactgatcagtaatgt |
35796256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University