View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15515_high_8 (Length: 250)
Name: NF15515_high_8
Description: NF15515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15515_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 38322213 - 38322439
Alignment:
| Q |
1 |
tgagcaatctgcaactacggctgtggagctatttccggggaatctcgttaacaaacaggtacatttttattcgtttcagtgaagggctatgtagtaccaa |
100 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| | |
|
|
| T |
38322213 |
tgagcaatttgcaactacagctgtggagctatttccggggaatctcgttaacaaacaggtacatttttgttcgtttcagtgaagggctatgtagcaccga |
38322312 |
T |
 |
| Q |
101 |
cagttttgatccaaaacgtgccctatatttgacatatgtcagtgtctgacaccgacacaatcctgacttatgcggttatatttaatcacttttactttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38322313 |
cagttttgatccaaaacgtgccctatatttgacatatgtcagtgtctgacacc-----------gacttatgtggttatatttaatcacttttactttct |
38322401 |
T |
 |
| Q |
201 |
taaactattacaaatgttaatgtccttgtttgcgtctg |
238 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38322402 |
taaactattacaaatgttaatgtccgtgtttgcgtctg |
38322439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University