View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15515_low_8 (Length: 250)

Name: NF15515_low_8
Description: NF15515
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15515_low_8
NF15515_low_8
[»] chr2 (1 HSPs)
chr2 (1-238)||(38322213-38322439)


Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 38322213 - 38322439
Alignment:
1 tgagcaatctgcaactacggctgtggagctatttccggggaatctcgttaacaaacaggtacatttttattcgtttcagtgaagggctatgtagtaccaa 100  Q
    |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |    
38322213 tgagcaatttgcaactacagctgtggagctatttccggggaatctcgttaacaaacaggtacatttttgttcgtttcagtgaagggctatgtagcaccga 38322312  T
101 cagttttgatccaaaacgtgccctatatttgacatatgtcagtgtctgacaccgacacaatcctgacttatgcggttatatttaatcacttttactttct 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||           |||||||| |||||||||||||||||||||||||||    
38322313 cagttttgatccaaaacgtgccctatatttgacatatgtcagtgtctgacacc-----------gacttatgtggttatatttaatcacttttactttct 38322401  T
201 taaactattacaaatgttaatgtccttgtttgcgtctg 238  Q
    ||||||||||||||||||||||||| ||||||||||||    
38322402 taaactattacaaatgttaatgtccgtgtttgcgtctg 38322439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University