View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15516_high_12 (Length: 219)
Name: NF15516_high_12
Description: NF15516
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15516_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 46 - 213
Target Start/End: Complemental strand, 33631895 - 33631728
Alignment:
| Q |
46 |
gacgtttgatgggttgttttagtttttgaaatgtgacactggaatgcttttgctgatgtgtattttctctttccatctaggcatccacatcgtctttctc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33631895 |
gacgtttgatgggttgttttagtttttgaaatgtgacactggaatgcttttgctgatgtgtattttctctttccatctaggcatccacatcgtctttctc |
33631796 |
T |
 |
| Q |
146 |
caccctcaccatcatcattagcaaactccgcatcaccacaatcacagatcaccaccctcctttgcttc |
213 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33631795 |
caccctcaccatcattgttagcaaactccgcatcaccacaatcacagatcaccaccctccattgcttc |
33631728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University