View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15517_low_5 (Length: 375)
Name: NF15517_low_5
Description: NF15517
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15517_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 4e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 17 - 163
Target Start/End: Original strand, 49669439 - 49669584
Alignment:
| Q |
17 |
taacaggtgtaaatttatatattttttagaaaacgtgtaaattttcaaatacgtacatgagtattttgannnnnnnncaaaaatgttttacagtgnnnnn |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || | |||| ||||||||||| |
|
|
| T |
49669439 |
taacaggtgtaaatttatatattttttagaaaacatgtaaattttcaaatacgtacatgagtatttcga-tttttttcgaaaacgttttacagtgaaaaa |
49669537 |
T |
|
| Q |
117 |
nnnntcggaaacacatatcttgaaatatttggtgggggtgaactcat |
163 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49669538 |
aaaatcggaaacacataccttgaaatatttggtgggggtgaactcat |
49669584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 267 - 351
Target Start/End: Original strand, 49669690 - 49669773
Alignment:
| Q |
267 |
gtacatgtgtcggggtataaagtgaaattttcagtgatcagttggaggcagcaattgtacaacaaaaatatggttactagccaaa |
351 |
Q |
| |
|
|||||||||||||| ||||| || ||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
49669690 |
gtacatgtgtcggg-tataaggtaaaattttcagtgatcggttggaggcagcaattgtacaacaaaaatatggtgactagtcaaa |
49669773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University