View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15518_high_9 (Length: 237)
Name: NF15518_high_9
Description: NF15518
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15518_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 79 - 225
Target Start/End: Original strand, 41299561 - 41299707
Alignment:
| Q |
79 |
ttttccgattaaattgaattgtattataattgattttatttaatctagaccatcaaattgattttagtgaaattatagttgttgaaatgaattagaattg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41299561 |
ttttccgattaaattgaattgtattataattgattttatttaatctagaccatcaaattgattttagtgaaattatagttgttgaaatgaattagaattg |
41299660 |
T |
|
| Q |
179 |
attttgaattctatcaaactaaaccctcttgggttggtctggtgatg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41299661 |
attttgaattctatcaaactaaaccctcttgggttggtcgggtgatg |
41299707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 41299453 - 41299534
Alignment:
| Q |
1 |
cctgatgtttttcttttgaagttttgttgcaaagatcggaaaggtcttttacatggtaattaatcttgggaaactccatttt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41299453 |
cctgatgtttttcttttgaagttttgttgcaaagatcggaaaggtcttttacatggtaattaatcttgggaaactccatttt |
41299534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University