View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15519_low_13 (Length: 213)
Name: NF15519_low_13
Description: NF15519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15519_low_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 52 - 197
Target Start/End: Complemental strand, 16919825 - 16919683
Alignment:
| Q |
52 |
tcaattcagaacacgcagatacaaaattataaacccaaattcattataaatcaacttaaaatcttagcatctttgccaaataaaattttgtgggttatga |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16919825 |
tcaattcagaacacgcagatacaaaattataaatccaaattcattataaatcaacttaaattcttagcatctttgccaaataaaattttgtgggttatga |
16919726 |
T |
|
| Q |
152 |
agctaatatatcaaatggcaaaatttaacaagaacagggatgagaa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16919725 |
agctaatatatcaaatggcaaaatttaac---aacagggatgagaa |
16919683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 75 - 119
Target Start/End: Original strand, 3932710 - 3932754
Alignment:
| Q |
75 |
aaattataaacccaaattcattataaatcaacttaaaatcttagc |
119 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3932710 |
aaattatatacccaaattcattctaaatcaacttaaaatcttagc |
3932754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 75 - 119
Target Start/End: Complemental strand, 44216472 - 44216428
Alignment:
| Q |
75 |
aaattataaacccaaattcattataaatcaacttaaaatcttagc |
119 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
44216472 |
aaattataaacccaaattcattctaaatccacttaaaatcttagc |
44216428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University