View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15519_low_6 (Length: 366)
Name: NF15519_low_6
Description: NF15519
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15519_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 8e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 165 - 351
Target Start/End: Original strand, 14050108 - 14050294
Alignment:
| Q |
165 |
gtggtgctacatttatttgatctattaccgtcattctttcttgtgataaatgacatttggaagaaaaacaactaggtaatttattcacgaattagctatg |
264 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14050108 |
gtggtgctacatttatttgatctcttactgtcattctttcttgtgataaatgacatttggaagaaaaacaactgggtaatttattcacgaattagctatg |
14050207 |
T |
 |
| Q |
265 |
tggatatttgtgttttttctaccatccttttaccgaaatgattttcnnnnnnngattgttatttcattgtttagctgttttgattct |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
14050208 |
tggatatttgtgttttttctaccatccttttactgaaatgattttctttttttgattgttatttcattgtttagttgttttgattct |
14050294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University