View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1552-INSERTION-2 (Length: 172)
Name: NF1552-INSERTION-2
Description: NF1552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1552-INSERTION-2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 5e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 5e-70
Query Start/End: Original strand, 6 - 167
Target Start/End: Original strand, 13409887 - 13410048
Alignment:
| Q |
6 |
cactaccatcgacattaaaaagctattgtatttttgttttaagtgaacgccattgtattgcatcaactattttctaacacatttcccaaataatatttgg |
105 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13409887 |
cactaccatccacattaaaaagctattgtatttttgttttaagtaaatgtcattgtattgcatcaactattttctaacacatttcccaaataatatttgg |
13409986 |
T |
 |
| Q |
106 |
ataaaagaagacatcccaaaatgccttcaaagtttgaaattgcatgaagattgtagctataa |
167 |
Q |
| |
|
||| |||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13409987 |
atagaagaagacatcccaaaatgctttcaaagtttgaaattacatgaagattgtagctataa |
13410048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University