View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15521_high_10 (Length: 346)
Name: NF15521_high_10
Description: NF15521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15521_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 5e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 51 - 198
Target Start/End: Complemental strand, 5689776 - 5689624
Alignment:
| Q |
51 |
agtggagaaataataagtggtttgatg---gattttgtaatggagatttttctttttgcataatgcttggaatgagtagttgtttgaatatgacaagg-n |
146 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5689776 |
agtggagaaataataagtggtttgatgattgattttgtaatggagatttttctttttgcataatgcttggtatgagtagttgtttgaatatgacaaggaa |
5689677 |
T |
|
| Q |
147 |
nnnnnntgatgcaaaagtaccttatggttgtcatcattg-ttttggaccataa |
198 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
5689676 |
aaaaaatgatgcaaaagtaccatgtggttgtcatcattgaatttggaccataa |
5689624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University