View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15521_high_15 (Length: 270)
Name: NF15521_high_15
Description: NF15521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15521_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 48413092 - 48412891
Alignment:
| Q |
1 |
aagacataccacataatcatccactttggtattctttatgagggcaatagtagggagaacgataatcttgagcttctcagctaaaaatggacttttttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48413092 |
aagacataccacataatcatccactttggtattctttatgagggcaatagtagggagaacgataatcttgagcttctcagctaaaaatggacttttttca |
48412993 |
T |
 |
| Q |
101 |
gcatttattttcacaaaccgagtctcaatatgctgcttagccaaaatacttaaatgcttgtccacaacctgcgaatgaactgtgagcacagatgtttcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412992 |
gcatttattttcacaaaccgagtctcaatatgctgcttagccaaaatacttaaatgcttgtccacaacctgcgaatgaactgtgagcacagatgtttcac |
48412893 |
T |
 |
| Q |
201 |
ct |
202 |
Q |
| |
|
|| |
|
|
| T |
48412892 |
ct |
48412891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 202 - 250
Target Start/End: Complemental strand, 48412835 - 48412787
Alignment:
| Q |
202 |
ttcaaattgatgataaacagatagataattcaaaatgaaatatctgcac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48412835 |
ttcaaattgatgataaacagatagataattcaaaatgaaatatctgcac |
48412787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University