View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15521_high_18 (Length: 233)
Name: NF15521_high_18
Description: NF15521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15521_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 219
Target Start/End: Complemental strand, 40902860 - 40902661
Alignment:
| Q |
20 |
taatcttccgtacttaaacgtaaccgagaagccaatgtaatcttccgtatttaaacgtatgtgtcacgccttcctgcagctgcactgtaggcagggcaat |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40902860 |
taatcttccgtacttaaacgtaactgagaaaccaatgtaatcttccgtatttaaacgtatgtgtcacgccttcctgcagctgcactgtaggcagggcaat |
40902761 |
T |
 |
| Q |
120 |
gaccagttcaacagcaggctgattttcttcatggttcagatttggactccaactccatttccagttctgcacaccatcggatgcagacagtttctgtgct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40902760 |
gaccagttcaacagcaggctgattttcttcatggttcagatttcgactccaactccatttccagttctgcacaccatcggatgcagacagtttctgtgct |
40902661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 133 - 219
Target Start/End: Complemental strand, 30149676 - 30149590
Alignment:
| Q |
133 |
gcaggctgattttcttcatggttcagatttggactccaactccatttccagttctgcacaccatcggatgcagacagtttctgtgct |
219 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
30149676 |
gcaggcagattttgttcatggttcagatttcgactccaacttcatttccagttctgcacaccatcggtctcatacagtttctgtgct |
30149590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University