View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15521_low_22 (Length: 202)
Name: NF15521_low_22
Description: NF15521
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15521_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 12 - 184
Target Start/End: Complemental strand, 10341129 - 10340957
Alignment:
| Q |
12 |
agatgaatattcaatacacgttcccttactgaaccgattagaagtaagaataagaaaataaataaaccaatatggacttatcaacgatagacaagattaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10341129 |
agatgaatattcaatacacgttcccttactgaaccgattagaagtaagaataagaaaataaataaaccaatctggacttatcaacgatagacaagattaa |
10341030 |
T |
 |
| Q |
112 |
ctaacatttacctcagaaccattttgaatatgtaattaatgattttatatatcaagaagttttgcactggaat |
184 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10341029 |
ctaacatttacttcagaaccattttgaatatgtaattaatgattttatatatcaagaagttttgcactggaat |
10340957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University