View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15522_low_9 (Length: 204)
Name: NF15522_low_9
Description: NF15522
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15522_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 81 - 191
Target Start/End: Complemental strand, 4949081 - 4948969
Alignment:
| Q |
81 |
tcgttgttaagtaaacttattgatgtagtagattaaat--tccttcaaatggttaattttgaatgattaaagcctgtcgtatgcttcccaggagatcctt |
178 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4949081 |
tcgttgttgagtaaacttattgatgtagtagattaaatattccttcaaatggttaattttggatgattaaagcctgtcgtatgcttcccaggagatcctt |
4948982 |
T |
 |
| Q |
179 |
tgctgtcacacag |
191 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4948981 |
tgctgtcacacag |
4948969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 15 - 44
Target Start/End: Complemental strand, 4949147 - 4949118
Alignment:
| Q |
15 |
atagtaaccctagaatccttatcaaaggac |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4949147 |
atagtaaccctagaatccttatcaaaggac |
4949118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University