View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15523_low_15 (Length: 457)
Name: NF15523_low_15
Description: NF15523
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15523_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 436; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 436; E-Value: 0
Query Start/End: Original strand, 1 - 448
Target Start/End: Complemental strand, 49133002 - 49132555
Alignment:
| Q |
1 |
cggcggtgatggtgatgatgtccagagcgtttatgtaatggttttttgctttcttcttcagaattttcgtccaaggacttctctgatgatcggcttcttc |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133002 |
cggcggtgatggtggtgatgtccagagcgtttatgtaatgattttttgctttcttcttcagaattttcgtccaaggacttctctgatgatcggcttcttc |
49132903 |
T |
|
| Q |
101 |
caccatgaccatgataatcagaatcagatgacctaacctctgtattatgtgatctcctatgatgcttatggtgccttctgtggcttctcttcctgtgaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49132902 |
caccatgaccatgataatcagaatcagatgacctaacctctgtattatgtgatctcctatgatgcttatggtgccttctgtggcttctcttcctgtgaat |
49132803 |
T |
|
| Q |
201 |
atcatcactttcatcacttgacaaatcagattcactagattccgagtggcggtggcgtttgtgatgctttccatgacctctcttccgatctgaacattcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49132802 |
atcatcactttcatcacttgacaaatcagattcactagattccgagtggcggtggcgtttgtgatgctttccatgacctctcttccgatctgaacattcc |
49132703 |
T |
|
| Q |
301 |
ccttcgtcactatagaaatcagaatcactaaattttgatggacgccgacgcctgtgccgcctttttctcttgttgacttcatcagcataagaatcagaac |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49132702 |
ccttcgtcactatagaaatcagaatcactaaattttgatggacgccgacgcctgtgccgcctttttctcttgttgacttcatcagcataagaatcagaac |
49132603 |
T |
|
| Q |
401 |
cactggaatttgatctcgaattttgatctcgaatcttcttcctttgct |
448 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49132602 |
cactggaatttgatctcgaatcttgatctcgaatcttcttcctttgct |
49132555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University